When MCF7 human breast cancer cells with very low endogenous mRNA level of OGR1 (Figure 1A) were transfected with the empty vector (control) or vectors containing OGR1 or GPR4 (a GPCR with the highest homology to OGR1), only those cells expressing OGR1 had significantly suppressed migration (Figure 1B), supporting an OGR1-specific inhibitory effect on cell migration.

To further study the inhibitory effects of OGR1 on cell migration, stable vector-, HA-OGR1-, and GPR4-expressing MCF7 clones were established. Real-time PCR analyses were performed to identify and confirm these stable clones (Figure 2A). The effects of stably expressed OGR1 and GPR4 on cell migration were assessed by both in vitro wound healing assays (Figure 2B) and transwell migration assays (Figure 2C). Consistent with the transient transfection studies, MCF7-OGR1 cells showed significantly reduced migration as compared to the parental, vector-transfected (MCF7-pHM6), or GPR4-transfected (MCF7-GPR4) MCF7 cells (Figure 2B and 2C). Consistent with the results in prostate [13] and ovarian cancer cells [16], GPR4 did not significantly affect MCF7 cell migration even though it shares approximately 54% homology with OGR1 (Figure 2B and 2C). These observations indicate that the cell migration inhibitory effect is specific to OGR1.

To investigate the mechanisms by which OGR1 mediated the inhibition of cell migration, we first tested its effects on Rho, Rac1 and Cdc42 [19-22]. Using Rho-GTP, Rac1-GTP and Cdc42-GTP pull-down assays, we found that the activation of Rho was significantly increased by OGR1 over-expression (Figure 3A). In contrast, Rac1 activity was substantially down-regulated in MCF7-OGR1 cells (Figure 3B). There was no significant change in Cdc42 activation (Figure 3C). Rho and Rac activation were not significantly affected in other control cell lines. These data correlated well with the migratory activities in each cell line (Figure 2).

To determine which G proteins might be involved the effects of OGR1, the effects of PTX (a Gα_i-selective inhibitor) treatment and the transfection of the Gα_12/13-selective blocker p115RGS on cell migration were tested. Transfection with p115RGS (RGS), but not PTX pretreatment, reversed the inhibitory effects of OGR1 on cell migration (Figure 4A), suggesting that OGR1 acted in a Gα_12/13-dependent manner.

The levels of activated Rho and Rac1 were analyzed after RGS transfection. RGS over-expression blocked the effect of OGR1 expression on Rho (Figure 4B) and Rac1 (Figure 4C). In contrast, PTX treatment had no effect on Rho or Rac1 activation (Figure 4B and 4C) in MCF7-OGR1 cells. Taken together, these data demonstrate that the Gα_12/13-Rho-Rac1 pathway is involved in the biological activities of OGR1 resulting in reduced cell migration in MCF7 cells.

FBS (10%) was used as a chemoattranctant in all transwell cell migration assays described in this work unless specified. When LPA or S1P (2 μM) was used alone (without FBS) as the chemoattractant, they increased migration of MCF7 cells (5–7 folds) as previously reported [28,29] (data not shown). Since the effects of OGR1 family GPCRs have been shown to be modulated by LPLs [9,10], we tested whether several lysophospholipids, including lysophosphatidic acid (LPA), lysophosphatidylcholine (LPC), sphingosine-1-phosphate (S1P), and sphingosylphosphorylcholine (SPC), could influence the inhibitory effect of OGR1 on cell migration induced by 10% FBS in human breast cancer cells. At 2 μM, SPC and S1P had significant effects on cell migration, but they did not affect the OGR1-induced inhibition of cell migration (Figure 5). LPC had an inhibitory effect on GPR4 over-expressing MCF7 cells (Figure 5), indicating that LPC might inhibit cell migration in a GPR4-dependent manner. However, none of these LPLs modulated the effect of OGR1 on cell migration in MCF7 cells.

LA Taq DNA polymerase, T4 DNA ligase, and restriction endonucleases HindIII and EcoRI were purchased from TaKaRa (Otsu, Japan). RNase I and ethidium bromide were from Sigma-Aldrich (St. Louis, MO, USA). Trypsinase and Vigofect were from Gibco (Carlsbad, CA, USA) and Vigorous Biotechnology Beijing Co. Ltd (Beijing, China), respectively. Pertussis Toxin (PTX) was purchased from ALEXIS Biochemicals (Beijing, China). Protease inhibitor cocktail tablets were obtained from Roche Applied Science (Rotkreuz, Switzerland).

The open reading frames (ORF) of OGR1 and GPR4 were amplified by PCR from cDNAs of MDA-MB-231 human breast cancer cells using primers (sense: 5′- TCGAATTCTCGGCCAACCTGCCCG -3′ and antisense: 5′- TAGAATTCGTGGCGACCGGTGGCTAGG -3′ for OGR1, and sense: 5′- TGAAGCTTCACCATGGGCAACC -3′ and antisense: 5′- CAGAATTCGGGGTCCATTGTG -3′ for GPR4). The amplified ORF was cloned into the mammalian expression vector pHM6 with an N-terminal HA-tag. The resulting expression constructs pHM6-OGR1 and pHM6-GPR4 were verified by DNA sequencing (Invitrogen, Beijing, China). Stable MCF7 cell colonies (monoclonal) were selected with 1000 μg/ml G418. Clones expressing OGR1, GPR4 or vector were designated as MCF7-OGR1, MCF7-GPR4, and MCF7-pHM6.

The RGS (the Gα_12/13 specific regulator of G protein signaling) domain of p115RhoGEF (p115-RGS, amino acids 1–252) was amplified by PCR from cDNAs of HepG2 human hepatocellular liver carcinoma cells using primers (sense: 5′- CCAAGCTTGCCCAGGGAGATGGAAGACTTCGC -3′ and antisense: 5′- GGAATTCCGGGCAGGCTCGTCCGACCG -3′).

MCF7 human breast cancer cells were cultured in DMEM (Gibco, Carlsbad, USA) supplemented with 10% FBS. MCF7-pHM6, MCF7-OGR1 and MCF7-GPR4 cell clones were cultured in DMEM supplemented with 10% FBS and 500 ng/μl G418 (Merck, Darmstadt, Germany). Cells were grown in a humidified atmosphere containing 5% CO₂ and 95% air at 37°C. Fresh medium was always added to the cells the day before an experiment.

Total RNAs were extracted and purified from MCF7 cells using the mRNA isolation system (Novagen, Darmstadt, Germany). cDNA was reversely transcribed from mRNA (1 μg) with oligo dT primers and/or random primers, using the AMV transcriptase RT kit (Takara, Otsu, Japan). The synthesized cDNAs (2 μl/reaction) were used as templates for the PCR reactions. PCR primers used were: human OGR1 (sense: 5′-TTCCTGCCCTACCACGTGTTGC-3′ and antisense: 5′-TGGCGAGTTAGGGGTCTGGAAG-3′); GPR4 (sense: 5′-TGGGCAACCACACGTGGGAG-3′ and antisense: 5′-TCCAGTTGTCGTGGTGCAGGAAGTA-3′); and human GAPDH (sense: 5′-ACCTCTATCGGGTGTTCGTG-3′ and antisense: 5′-TTCCTCTTGGAGGTGAGTGG-3′). PCR reactions were carried out by initial denaturation, 1 cycle at 94°C for 5 min, followed by 30 cycles of denaturation (94°C for 30 s), annealing (58°C for 30 s), and extension (72°C for 30 s) with 2.5 units of Promega Go Taq polymerase. This was followed by a final extension step of 72°C for 7 min. At the end of the PCR amplification, PCR products were analyzed by 1.5% agarose gel electrophoresis and Gold-view staining.

Real-time PCR analyses were performed using the following primers: human OGR1 sense: 5′-CACCGTGGTCATCTTCCTG-3′ and antisense: 5′-GGAGAAGTGGTAGGCGTTGA-3′, GPR4 (sense: 5′-TGGGCAACCACACGTGGGAG-3′ and antisense: 5′-TCCAGTTGTCGTGGTGCAGGAAGTA-3′) and human beta-actin sense: 5′-GAAGTCTGCCGTTACTGCCCTGTGG-3′ and antisense: 5′-CCCTTGAGGTTGTCCAGGTGAGCCA -3′. The annealing temperature for the real-time PCR was 60°C for 45 cycles. Beta-actin was amplified as an internal reference. All real-time PCR reactions were performed in a 20 μl mixture containing 1 μl cDNA preparation, 1× SYBR Green buffer (PE Applied Biosystems, Foster City, CA, USA), 4 mM MgCl₂, 0.2 μM of each primers, 0.2 mM dNTPs mix and 0.025 Unit of AmpliTaq Gold® thermostable DNA polymerase (Applied Biosystems, Foster City, CA, USA). Real-time PCR and quantitations were performed using the BioRad iCycler iQ system and software (BioRad, Hercules, CA, USA).

For the wound healing assays, an area was scraped free of cells with a 20 μl pipette tip and cell migration into the wounded area was monitored every hour using a Multi-Dimensional Workstation for Live Cell Imaging (Carl Zeiss, Oberkochen, Germany).

For the in vitro transwell migration assay, cells were cultured to 85-95% confluence (cells were not starved before), trypsinized and washed twice with PBS. Cell culture medium with 10% FBS (500 μl) was added to the lower chambers of a 24-well transwell plate (8.0 μm pore size; Corning Inc, Corning, NY). Cells (10⁵ cells in 200 μl serum-free media) were added to each insert and plates were incubated for 16 h at 37°C. Non-migrating cells were removed with a cotton swab. Migrated cells were fixed in methanol for 30 min and stained with crystal violet (1 mg/mL, Fluka Chemical Corp, Milwaukee, WI) for 30 min at room temperature. Excess stain was removed with water, and the chambers were air-dried. Migrated cells were visualized under the microscope and quantified by counting the number of cells in three randomly chosen fields. The final results were presented as relative percentages with the number of cells migrated in the control wells defined as 100%. At least 5 independent experiments were performed, each in triplicate.

Rho, Rac1, and Cdc42 activation assays were conducted following the manufacturer’s protocol (Millipore, Billerica, MA, USA). In brief, cells were washed with ice-cold PBS and lysed in a lysis buffer (50 mM Tris–HCl [pH 7.2], 500 mM NaCl, 10 mM MgCl₂, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 5 μg/mL of leupeptin and aprotinin, 0.1 mM PMSF). Cell lysates were clarified by centrifugation at 13,200 rpm at 4°C for 30 min, and equal volumes of lysates were incubated with GST-p21-activated kinase (PAK) (for determination of Rac and Cdc42 activities) bound to glutathio ne-Sepharose 4B beads (Millipore) at 4°C for 60 min. The beads were washed three times with a washing buffer (50 mM Tris–HCl [pH 7.2], 150 mM NaCl, 10 mM MgCl₂, 1% Triton X-100, 5 μg/ml of leupeptin and aprotinin, 0.1 mM PMSF). Bound Rho, Rac1 or Cdc42 protein was detected by Western blotting using specific monoclonal antibodies (Millipore, Temecula, CA); total Rho, Rac1, Cdc42 and α-tubulin were detected by whole cell lysate Western blotting.

MCF7 cells were washed three times with ice-cold PBS and lysed in a cell lysis buffer (10 mM Tris [pH 7.7], 150 mM NaCl, 7 mM EDTA, 0.5% NP-40, 0.2 mM PMSF and 0.5 μg/ml leupeptin) for 15 min on ice; the lysate was centrifuged at 14,000 g for 30 min at 4°C and the supernatant was collected. The protein concentration was determined using the BCA™ Protein Assay Kit (Pierce, Rockford, IL, USA). The samples were stored at −20°C until subjected to SDS-PAGE (12% polyacrylamide). The proteins were transferred onto PVDF membranes (Schleicher & Schuell, Dassel, Germany). Western blot analysis was performed using specific antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) to the indicated proteins. The secondary antibodies used were alkaline phosphatase-conjugated anti-mouse and anti-rabbit antibodies (Sigma-Aldrich, St. Louis, USA). The proteins were detected by enhanced chemiluminescence (Promega, San Luis Obispo, CA, USA).